| 產(chǎn)品名稱(chēng) |
Candida geochares (van der Walt et al.) Meyer et Yarrow |
| 商品貨號(hào) |
B166028 |
| Deposited As |
Torulopsis geochares van der Walt et al. |
| Strain Designations |
CBS 6870 [CCRC 22394, IFO 10278, NRRL Y-17073] |
| Application |
quality control strain |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
freeze-dried |
| Storage Conditions |
Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section |
| Type Strain |
yes |
| Preceptrol® |
no |
| Morphology |
After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 μm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin. |
| Medium |
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
|
| Growth Conditions |
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TCCGTAGGTGAACCTGCGGAAGGATCATTTCTGAATCTTCTACACACAGTGACACGAACAAGTGACGCGCAGCGGCACTTGTGATTGCTTCCGGTTCGCCGGGCTTTAACAACAACCAAATTAATCTGACAACGAAAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTGCGCCAGTTTACTGGCATACTGCGTTGAGCGTCGGCCTTCCTCCACAGGTAATGCTACTTTCAGTAGTTAAAGGCATGGAAATGCACCCGTTAGCAAAACGGTGCACACCACAAAAATTCGACCTCAGCGTAGTAAGATTACCCGCTGAACTTAAG
D1D2 region of the 26S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAATGGCGAATGAACAGGCAAAAGCTCAGATTTGAAACCCTCGGGATTGTAATCTGAAGACCTGGATTTGGCAGGCTGACCAAGTCTTCTGGAATGGAGCGCCATGGAGGGTGACAGCCCCGTAGCAGCAGCCATTGTAAATCCGGGTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATGCTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAATGGAAGGCAATGAGGTGCGATTGAACCGGACGTTTGCGGGCAGGACAAAAGCGCAGGCCGCCTCGGCATTGCCTGCGTGCATACTGCCTCGCGGACTACCAGTTCTAACAACGCCTTATTGCAC
|
| Name of Depositor |
CBS |
| Chain of Custody |
ATCC <-- CBS <-- J.P. van der Walt |
| Isolation |
Grassland soil; South Africa |
| References |
van der Walt JP, et al. Torulopsis geochares and Torulopsis azyma, two new haploid species of ascomycetous affinity. Antonie van Leeuwenhoek 44: 97-104, 1978. PubMed: 566080
YT MicroPlate QC Set. Biolog.
Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281
Suzuki M, Nakase T. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol. Cult. Collect. 14: 49-62, 1998.
Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410
|
